Cavy systems where they would constitute with the rabbit

Cavy is a promising livestock especially in sub-SaharanAfrica because it requires little capital, provides quality and cheap meat (NRC,1991; Lammers et al., 2009), can be afford by poor people. Cavies are early andprolific (Dikko et al., 2009; Lammers et al.

, 2009), when subjected to adequatenutrition and clean environment, they reproduce rapidly with less health carecompared to other species such as rabbits (NRC 1991; Lammers et al., 2009) andtherefore constitute a guarantee of food security (Ngoupayou et al., 1995). In most countries of the Great Lakes regions,cavies are predominantly higher than rabbits or pigs (Metre, 2012; Maass et al.,2012). They are well suited to family farming systems where they wouldconstitute with the rabbit the major source of animal protein for family consumption,other species serving as source of income for the household (Lammers et al.,2009; Metre, 2012; Maas et al., 2013).

Best services for writing your paper according to Trustpilot

Premium Partner
From $18.00 per page
4,8 / 5
4,80
Writers Experience
4,80
Delivery
4,90
Support
4,70
Price
Recommended Service
From $13.90 per page
4,6 / 5
4,70
Writers Experience
4,70
Delivery
4,60
Support
4,60
Price
From $20.00 per page
4,5 / 5
4,80
Writers Experience
4,50
Delivery
4,40
Support
4,10
Price
* All Partners were chosen among 50+ writing services by our Customer Satisfaction Team

In eastern DRC, it is currently kept by eightout of ten households, with numbers ranging from 6 to 30 (Mass et al., 2010; Metre, 2012). Thisagrees with previous observations by Schoepf and Schoepf (1987), who reportedabout one third of surveyed households in DRC.

Previouslyconsumed exclusively by children, it has become a source of protein for all categoriessince the 1990s (Vlassenroot, 2008; Metre, 2011). In urban areas, however,consumption remains limited due to the accessibility and consideration of caviesas an animal of poor (Maass et al., 2010; Maas et al., 2013; Maass et al.

, 2014).In sub-Saharan Africa, despite the benefits of cavyhusbandry in the socio-economic at household level, their population remainspoorly documented, as they are not included in national census except inTanzania (NBS, 2012). Cavy population in DRC is estimated to be more than2 million, contributing significantly to nutrition security, especially foranimal protein, and income generation of more than a hundreds of thousands of poorrural and urban households (Maass et al., 2013). The largest cavy populations arekept in the Kivu provinces, where they are part of ‘rehabilitation kits’ ofhumanitarian NGOs and because they are included in the agricultural portfolioof development agencies who seek to address the challenges of widespread hungerand malnutrition in the area (Maass et al.

, 2013). However, despite the role ofcaviaculture in the household livelihood, their history remains unknown and notdocumented. Recent research on diversity assessment indicated the existence ofthree genes pools in the country. However there were limitation on gene flowfor better caption of the genetic diversity that can guide improvementstrategies (Ayagirwe et al., 2017 unpublished data).  Although it is believed that cavies wereintroduced into Africa by missionaries during the colonial period.

Cavy productionsystem has evolved leading to enormous changes in their production and geneticdiversity (Ngou Ngoupayou et al., 1995; Manjeli et al., 1998; Metre, 2005).Theorigin of cavies in DR Congo is currently unknown. It is thought that the firstcavies were kept in the catholic convents led by Belgian and Italian Jesuitmissionaries, around early 20th century when the Catholic Church wasestablished in Bushi area in Sud-Kivu (Nkunzi, 2005). However that historyrelayed on information assembled by word-of-mouth and gathered over decades indiscussions with old (± 80 years) key informants from different villages as noknown written records exist on the history of cavy culture anywhere in DRC(Maass et al.

, 2013), as it is the case of other African countries likeCameroon (Yiva et al., 2014). In this work we proposed to assess the phylogenyand evolution story of cavy raised for meat consumption in DRC using the veryconservative region of the cytochrome b gene. The objective of this work was 1)to assess the phylogenetic position of the DR Congo cavies populations, inorder to discern if all share a common origin or if they are the result ofindependent evolutionary events, and 2) to evaluate the evolutionary affinitiesamong the DRC Cavies and others American and European populations, in order totest previous hypotheses that suggest a close relationship among them.

  1.   Methodology1.1.       Sampledarea    The sampling zone belongs to four different provinces ofRD Congo.

Located on both sides of the Equator, extending between 5° 20′ northlatitude and 13° 50′ south latitude, between 12° 15’and 31° 15 ‘east longitude.Its natural environment consists of the essential factors that contribute tothe quality and variety of agro-pastoral potential and offer an ecosystem conduciveto the promotion and sustainable development of plant and animal production.There are four climatic zones: (i) the equatorial zone at the center, with awarm and humid climate, temperatures varying between 20°c and 32°C, heavyprecipitation exceeding 2,000 mm per year regularly distributed throughout theyear; (ii) the tropical zones, with two very marked seasons as one moves awayfrom the Equator.  These are: (a) the rainy season, characterized byprecipitation ranging from 800 to 1,500 mm per year and fluctuatingtemperatures between 25° and 33°c; (b) the dry season, which can last from 1 -3 months in the North and from 1 to 6 months (of dry season), in the South,with temperatures ranging from 17° to 25°C.

(iii) the monsoon climatetransition zone, separating humid equatorial and tropical climates, and (iv)the relatively temperate zone in the eastern part of the country with specialrainfall conditions (on average 60 mm per month), with temperatures varyingbetween 8°C and 18°c due to the elevation of the relief (FAO, 2010). Thedifferent sampled areas are shown in figure 1. Bloodsamples were collected from 96 adults in four provinces of the DRC, 24 samplesper region (South and North Kivu, Katanga and Kinshasa) based on theirphenotypic variability, geographic distance location and genetic distance.Blood samples from each animal was collected from ears and stored on FTA cards(Whatman® FTA® card technology, Sigma-Aldrich). 1.2.       TotalDNA extraction and PCR amplificationTotalDNA extraction was carried out at BecA-ILRI Hub using FTA™ Purification Reagentaccording to the manufacturer’s protocol.

A pairs of primers were designed basedon the cytochrome b gene of the cavy reference sequence NC_000884.1 (D’Erchiaet al., 1996) deposited in GenBank. Primer pairs were designed (Froward:GCATCTGTCTAGGCCTGCAA and Reverse: GGTTGGCGGGTGTGTAGTTA) to cover variableregions of the cytochrome b gene, with the primers situated in conservedregion.

The amplification products ranged from 600 to 670 base pairs after trimming.ThePCR amplification was done in a 50 µl reaction volume containing 45 ng DNA, 1XAccuPower PCR Master Mix (Bioneer, Korea), 0.09ng of each primers and 0.5 mM ofMgCl2 as top up. PCR amplification was performed in a GenAmp ® 9700PCR system Thermal Cycler (Applied Biosystems) using the following thermalcycling conditions: initial denaturation of 5 min at 95°C followed by 35 cyclesof 45s denaturation at 94°C, 60s primer annealing at 58°C and 1 min primerextension at 72 °C, and then a final extension step of 15 min at 72 °C. PCRproduct were then evaluated using 1.8% agarose gel on electrophoresis. Prior tosequencing, amplified products were purified using aquick-start protocol of Qiagen Qiaquick® Gel Extraction Kit as recommended bythe manufacturer (QIAGEN Inc.

) and visualized on 0.8% agarose gels. Sampleswere sequenced using the BigDye Terminator v3.1 Cycle Sequencing Chemistry(Applied Biosystems) and the ABI Prism 3130XL automatic capillary sequencer(Applied Biosystems, USA) following the manufacturers recommendations by usingthe same primers set as described above.1.

3.       DataAnalysisSequenceswere assembled and trimmed using the CLC Main Work bench 7.8.1.

Both strands ofall sequences were obtained and after blast and conflict resolution, they werefree of indels, premature stop codons and ambiguities in forward and reversedirections, providing support for their mitochondrial origin (Triant andDeWoody, 2007). Phylogenetic analysesToevaluate the DRC cavy population phylogeny, two representatives of the Musfamulus, one of the Oryctolagus cuniculus and one of the Caprolagus hispidusdownloaded from NCBI genbank were include as outgroup taxa. Ten sequences ofwild cavies from genbank have been as well used to evaluate the relationshipbetween DRC cavies with their closely related: Cavia tshudii (2), C. magna (2),C. fulgida (2), C.

apera (2) and C. patzelti (2). However to compare domesticcavies from DRC with other cavy populations, 18 sequences have been downloadedfrom the NCBI genbank (one from Europe, six from Colombia, five from Peru, twofrom Chili, three from Bolivia and one from Ecuador). Details for thedownloaded sequences are given in table 1.Multiplealignments were first performed and displayed using the Mega6 (Tamura, 2013),then carefully examined and manually edited to maximize the overall similarity.The Bayesian Information Criterion were used to describe the best evolutionarymodel for these data. Akaike Information Criterion identified the Kimura 2-parameter modeltakinginto account the proportion of invariable sites and following a gammadistribution for variable sites as most appropriate fit to our data (Kimura, 1980) due to its lowest maximum loglikelihood (-1195.4608) and lowest Bayesian InformationCriterion (4941.

856) with the highest Akaike Information Criterionidentified (2855.565). The tree with thehighest log likelihood is shown. The percentage of trees in which theassociated taxa clustered together is shown next to the branches. Initialtree(s) for the heuristic search were obtained by applying the Neighbor-Joiningmethod to a matrix of pairwise distances estimated using the Maximum CompositeLikelihood (MCL) approach. A discrete Gamma distribution was used to modelevolutionary rate differences among sites. The tree is drawn to scale, withbranch lengths measured in the number of substitutions per site. 1000 bootstraphave been used and the analysis involved a total of 634 positions in the finaldataset.

Evolutionary analyses were conducted in MEGA6 (Tamura et al., 2013).2.   Results2.

1.       Phylogeneticrelationship between DRC Cavies and their relatives wild caviesThephylogenetic tree based on genetic distances and reconstructed by NJ is shown inFig.2. The topology reported shows three major clusters, one including domesticatedcavies from DR Congo with their closely related Cavia utschudii withrelatively high bootstrap values. One with only Cavia magna (100 bootstrap value) and the third comprising Cavia apera, C.

fulgida and C. patzelti although bootstrap supportfor this clade was relatively low (Fig. 2). It appears that the studied DRC cavy population clustered far apart fromthe wild cavies and are only related with C.utschudii (bootstrap value more varying between 80 and 100%).

The differentwild cavies are distinctly different from one another based on the length ofthe branches. In DRC population however there is sub-clustering of thedomesticated cavies which shows relatively two groups (bootstrap value = 60%).  2.2.       DRCCavy population phylogeny compared to their clothier taxaThefigure 3, based on genetic distances and reconstructed by NJ, it indicates thatthere is three clusters. A clear differentiation is observed between cavypopulations from DRC and two others clusters comprising of the Mus famulus and the Oryctolagus cuniculus clustered with Caprolagus hispidus.

However on that phylogeny tree it appears that cavy populations are moreclothier to mouse than they do for rabbit. All the cavies from DRC clustered in a unique big cluster with 99%bootstrap value. Between the DRC cavy population cluster, there is existence ofsub-clustering. However, that clustering is not due to cavy population origin.Some individuals from Kinshasa clustered far apart from the rest of the groupwith 60% bootstrap value.

The existence of the admixture of cavy individualsfrom different regions implies the evidence of sharing the same geneticbackground and the exchange at a certain level of the genetic materials. Thelow genetic distance exiting between these populations. 2.3.       DRCCavy population relationship compared to other Latin American domesticated cavypopulationsThe history of cavy introduction inDR Congo is not known.

Their origin is however speculated as well as theintroduction and dissemination route. It is believed that they came from SouthAmerica but the real country of origin is not yet clearly established. Weconsidered cavies from six Latin American countries (Peru, Colombia, Chili,Ecuador, Bolivia and Argentina) and from Europe to trace the dissemination routeand probable country of origin. From the figure it appears that all DRC cavieswere clustered with a pet cavy form Argentina and Europe as well as with someindividuals from Peruvian domestic cavy (with 66% confidence).

The secondcluster belongs to cavies from Colombia which are as well clothier to DRCcavies than the rest do. Some sequences of cavies from Chili, Bolivia, Peru andColombia clustered together and are the one very distant from the DRC sequences.Possible existence of high genetic diversity exist in South America populationand only a narrow genetic material have moved to Europe during the immigration.As it have been shown previously, the European specimens clearly originate fromSouth America (see Spotorno et al., 2006); and suggestion that European cavieseither originate from the Caribbean or possibly directly from Colombia andPeru. It is as well clear that cavies transited from Europe before introductionto Africa.

The presence of Argentina pet in the same cluster of DRC cavies andEurope is in accordance with the migration purpose of cavy as laboratory andpet animal than the actual use it deserve in Africa as source of meat forconsumption. 2.4.       DiscussionCavies are reported to have beendomesticated at least 4.500 years ago (Sandweiss and Wing, 1997) in the highlands of South Americaproviding the Indians with meat and sacrificial animals. However, opinion stilldived on the real ancestor of Caviaporcellus as two wild cavy were known to be related; C.

apera and C. utschudii.These two wild cavies are known to reproduce with the domesticated caviesfertile offspring (Kruska and Steffen, 2012; Kruska, 2013).

Kruska and Steffen(2012) observed when doing comparative allometric investigations on the skullsof wild cavies (Cavia aperea) versusdomesticated cavies (C. porcellus)that C. apera is the ancestor of thedomesticated cavies. “Cavia tschudii” mainly distributed in Peru andChile being considered as a subspecies of the species Cavia aperea, which is widely distributed on the South American continent.This have been based on configuration of the upper M3 occlusal surface of allthe wild Cavia aperea including thosefrom Andean regions but also from far northern and far eastern distribution aswell as of the domesticated cavies. When comparing chromosome (Weir 1974;Künzel and Sachser, 1999) as well as DNA investigations (Trillmich et al.,2004), these different authors suggested the origin of domesticated cavies fromCavia aperea.

However, Recently Spotorno et al.(2004, 2006, 2007) revitalized older assumptions, when investigating the originof domesticated cavies by use of molecular genetic methods as well as skullmeasures and some other morphological traits. As a result they derived alldomesticated cavies from a species Caviatschudii with a distribution in the East Andean regions of Peru andnorthern Chile rather than from the species Caviaaperea of adjacent Bolivia.In this study, domesticated caviesfrom DRC clustered with C. utshudiiand far apart from C. apera whileusing cytochrome b gene sequences. However phylogenetic inference determinedthat Cavia porcellus species sharehereditary characteristics with para phyletic group Cavia tschudii and Caviaaperea animals confirming Caviaporcellus offspring from Caviatschudii (Diaz et al., 2016).

The history of cavy introduction inDR Congo is not known. Their origin is however speculated as well as the routeof introduction. It is believed that they came from South America but the realcountry of origin is not yet clearly established.

Two possible introduction toAfrica are reported; Blench (2000), assumes that they have only been introducedby Christian missionaries and colonial agricultural officers. Whereas Morales(1995) suggests that the misnomer ‘Guinea pig’ may have inferred from the European assumption that cavies came from theWest African coast of Guinea after being imported from South America via theGuinea slave trade ships. From this study, it appears that all DRC cavies wereclustered with a pet cavy from Argentina and Europe as well as with someindividuals from Peruvian domestic cavy.

It is there clearly showed thatdomesticated cavies in DRC were most likely from Peru and Colombia and have transitedby Europe before their introduction in Africa. This would suggest as wellvarious introduction of animals from the two countries. However, depending ontheir small size characteristics they still comparable with their closelyrelated cavies (Criollos) which still be founded in rural areas in LatinAmerica. The present South American populations are probably the descendants ofpre-Columbian lineages. Whether Andean and laboratory/pet breeds aregenetically distinct is uncertain (Spotorno, 1982).

However Cavia porcellus have been well-knowndomestic pets since their introduction to Europe in the sixteenth century, fromundocumented sources (Woods, 1993; Woods and Kilpatrick, 2006); they became theprototype of laboratory models through the nineteenth century (Wagner andManning, 1976). However they probably had a recent common ancestor around thesixteenth century (Wagner and Manning, 1976). In fact, molecular analyses ofPeruvian cavies breeders (Chauca, 1997) differentiate with the prolific,large-sized cavies exhibiting a calm behavior (improved cavies), and thesmall-sized, nervous ones (the “criollos” = creoles), typically found in ruralhouses (Archetti, 1997), suggest that improved cavies share a most recentcommon ancestor with the European cavy which is not the ancestor of creoles(Spotorono et al.

, 2004). Cavies brought to Europe were then subjected tofurther selective breeding leading to the common domestic form that is nowadaysused as pets and laboratory animals (Spotorno et al., 2006). Their wild relative, the wild cavy(Cavia aperea) still is one of themost common and widespread rodents of South America (Asheret al., 2004; Asher et al.

, 2008 and Rood, 1972).Domesticated cavies follow a three-stepprocess (Spotorno et al., 2006): a first ancient domestication (Wing, 1986),from the wild species to the domestic pre-Columbian cavy, still bred as the’criollo’ (creole) breed throughout the Andean countries; a second stepinvolving European peoples, who took a few in the XVI century and transformedthem into the present worldwide laboratory/pet cavy (Spotorno et al.

, 2004);and a third step involving a modern selection regime of creole cavies (Chauca, 1997),to produce an improved animal for meat production known in South Americancountries (Morales 1995). This have been made possible, in recognition that caviescan reproduce up to five generations per year (Trillmich, 2000) and concerningthe length of the domestication period they thus have lived under thisinfluence for much more generations than have the other domesticated lagomorphsand rodents and even than the other so?called classical domesticated forms(e. g., dog, sheep, goat, cattle, pig, etc. (Kruska, 2013)) which led to verydifferent cavies categories.

From Europe cavies have been then introduced toAfrica during precolonial period. However in DRC, the period of thatintroduction still unknown. It has been conveyed that the first cavies wereheld in the catholic convents in Sud-Kivu, led by Belgian and Italian Jesuitmissionaries, probably starting around the early 20th century, when theCatholic Church established itself in the Bushi area (Nkunzi, 2005). In theearly colonial period, local people had no specific interest in cavies. Though,some of those working in the convents introduced the animal into their villages(Mugisho, 1995), probably to supply meat to their children. Many people,however, thought cavies were a kind of rat and, hence, adults scorned theirchildren’s animal inside the houses.However, the chaos caused by thesuccession war for the Mwami Kabare (1985-1987) resulted in widespread famineand high levels of malnutrition, especially in children (Makungu, 2006). Then,cavies became considered as a ‘medical treatment’ for malnutrition,particularly in overcoming anemia (Mugisho, 1995).

Some NGOs, such as ComitéAnti-Bwaki5, recommended that children received cavy blood, mixed with CocaCola and tomato concentrate to overcome the condition. The belief that cavyblood and meat has a health-improving effect especially for childrenperpetuates until today, also in other parts of the country (B Kajinga-Mutombo,2013, pers. comm.).In a survey conducted in the early1980s in four mountainous localities in Kabare territoire of Sud-Kivu nearMulungu, Schoepf and Schoepf (1987) found that in one third of the 160households visited, older children raised cavies, which they consumed.

This hasto be seen in the context where mothers usually leave starchy staples preparedin the home before they leave to the fields; when children return from school,they prepare cavy stew by themselves. Kunze et al. (1991) recognized theimportance of cavy culture at that time in Kabare territoire based on itsprevalence and its reported contribution to animal-source protein provision forchildren. Mugisho (1995) describes cavies as “omnipresent” in Mulambagroupement in Walungu territoire, the large majority (83%) of 40 interviewedhouseholds from four villages kept cavies successfully for a long time, meaningat least since independence in the 1960s.All DRC cavies were clustered inonly one group with less differentiation. When establishing a nucleus of caviesfor a selection program in the Institut supérieur agro-vétérinaire inMont-Ngafula in Kinshasa in 2008, populations were introduced from the Kivuprovinces, Lubumbashi and different villages and cities in the Bas-Congo province,such as Kimpese and Kisantu.

Strong cavy nuclei seem to thrive unnoticed in allthese areas as very few official reports are to be found that mention cavies(Maass et al., 2013). This movement of animal may be one of the raisons why DRCcavy are closely related. 3.   ConclusionThestudied cavies from DRC were less differentiated due to the animal exchange andgenetic introgression. The phylogenetic tree confirmed the hypothesis of C.

utschudii being the ancestor ofdomesticated cavies. The most plausible road of dissemination of cavies wereLatin America to Africa via Europe and not the direct introduction. Caviestransited in Europe with the purpose of research and pet before being used asmeat source in Africa. That road of dissemination may reflect as well the geneflow and would be tracked in improvement process. Possible existence of high geneticdiversity exist in South America population and only a narrow genetic materialhave been introduced to DRC via Europe during the immigration.4.   AcknowledgementsWe acknowledge the Biosciences eastern and central Africa- International Livestock Research Institute (BecA-ILRI) Hub, through AfricaBiosciences Challenge Fund (ABCF) program for funding this work.

The ABCFProgram is funded by the Australian Department for Foreign Affairs and Trade(DFAT) through the BecA-CSIRO partnership; the Syngenta Foundation forSustainable Agriculture (SFSA); the Bill & Melinda Gates Foundation (BMGF);the UK Department for International Development (DFID) and; the Swedish InternationalDevelopment Cooperation Agency (Sida). The BESUP from the Eglise du Christ auCongo (ECC) for supporting financially the field work. We thank as well allcavy owners in DR Congo for providing unreserved access to their animals forsampling.